Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001))

Rayment, Neil and Rhodes, Glenn and Hudspith, Barry and Hughes, Valerie and Chianini, Francesca and Agrawal, Gaurav and Bull, Tim J. and Pickup, Roger and Sanderson, Jeremy (2024) Corrigendum to “Visualisation of Mycobacterium avium subsp. paratuberculosis in cultured cells, infected sheep and human tissue sections using fluorescent in situ hybridization (FISH)” [Journal of Microbiological Methods 224 (2024) 107001] (Journal of Microbiological Methods (2024) 224, (S0167701224001131), (10.1016/j.mimet.2024.107001)). Journal of Microbiological Methods, 225: 107024. ISSN 0167-7012

Full text not available from this repository.

Abstract

The authors regret that an incorrect sequence was included in line 47 of our submitted manuscript which omitted the inclusion of the two extra GC nucleotides at positions 7&8 n the sequence. Currently the manuscript reads “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions -7 and -8, termed P90CorrProbe (5’-GTTCGGGGCCGTCGCTTAGG-3’).” but should have read “Here we report on the use of the corrected version of the Romero et al. (2005) FISH probe incorporating GC nucleotides at positions −7 and −8, termed P90CorrProbe (5′GTTCGGGGCCGTCGGCCTTAGG–3′). The authors would like to apologise for any inconvenience caused.

Item Type:
Journal Article
Journal or Publication Title:
Journal of Microbiological Methods
Uncontrolled Keywords:
/dk/atira/pure/subjectarea/asjc/2400/2404
Subjects:
?? microbiologymolecular biologymicrobiology (medical) ??
ID Code:
226878
Deposited By:
Deposited On:
14 Jan 2025 15:55
Refereed?:
Yes
Published?:
Published
Last Modified:
14 Jan 2025 15:55